View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0225-INSERTION-2 (Length: 270)
Name: NF0225-INSERTION-2
Description: NF0225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0225-INSERTION-2 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 7 - 270
Target Start/End: Complemental strand, 42677295 - 42677032
Alignment:
| Q |
7 |
accaaaaatgtcttgattttctggtggaaattctcaatctcttgatggttccaaattgtccaaaataagcttccgccatctccatctctttgaagccatg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
42677295 |
accaaaaatgtcttgattttctggtggaaattctcaatctcttgatggttccaaattgtccaaaataagctttcgccatctccatctcttagaagccatg |
42677196 |
T |
|
| Q |
107 |
tggaatcaacccaatatacaaaacatgggaagtattctccaatggtttgcggctaggaccagcttccaacgacaaaaaatcagcaccatgctcaaatgga |
206 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42677195 |
tggaatcaaaccaatatacaaaacatgggaagtattctccaatggtttgcgactaggaccagcttccaacgacaaaaaatcagcaccatgctcaaatgga |
42677096 |
T |
|
| Q |
207 |
aaaaattaaatggcaatggctttataccacacgaaagagatctgattacactaaaacatattcg |
270 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42677095 |
tagaattaaatggcaatggctttataccacacgaaagagatctgattacactaaaacatattcg |
42677032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 77
Target Start/End: Complemental strand, 52835009 - 52834967
Alignment:
| Q |
35 |
aattctcaatctcttgatggttccaaattgtccaaaataagct |
77 |
Q |
| |
|
||||||||||||||||| ||| || |||||||||||||||||| |
|
|
| T |
52835009 |
aattctcaatctcttgacggtaccgaattgtccaaaataagct |
52834967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 7e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 31 - 77
Target Start/End: Original strand, 48969535 - 48969581
Alignment:
| Q |
31 |
tggaaattctcaatctcttgatggttccaaattgtccaaaataagct |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48969535 |
tggaaattctcaatctcttgatggttccaaattgtccaaaataagct |
48969581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 82 - 154
Target Start/End: Original strand, 48969712 - 48969784
Alignment:
| Q |
82 |
ccatctccatctctttgaagccatgtggaatcaacccaatatacaaaacatgggaagtattctccaatggttt |
154 |
Q |
| |
|
|||||||| |||| | |||||||||||||||| ||||||||||||||| |||||| |||||||||| |||| |
|
|
| T |
48969712 |
ccatctccttctcatagaagccatgtggaatccgaccaatatacaaaacaggggaagaattctccaattgttt |
48969784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1798 times since January 2019
Visitors: 2393