View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0225-INSERTION-4 (Length: 130)

Name: NF0225-INSERTION-4
Description: NF0225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0225-INSERTION-4
NF0225-INSERTION-4
[»] chr5 (1 HSPs)
chr5 (8-130)||(6039556-6039679)


Alignment Details
Target: chr5 (Bit Score: 112; Significance: 5e-57; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 8 - 130
Target Start/End: Complemental strand, 6039679 - 6039556
Alignment:
8 caatctactagaattttatcgttcaagacaatagaagtagatgaatttggatagagtaacaa-aaaagaagaagatgaatttggatagaggtgaacaaat 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||    
6039679 caatctactagaattttatcgttcaagacaatagaagtagatgaatttggatagagtaacaaaaaaaaaagaagatgaatttggatagaggtgaacaaat 6039580  T
107 aaatttgtttgccgccccctaatt 130  Q
    ||||||||||||||||||||||||    
6039579 aaatttgtttgccgccccctaatt 6039556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1487 times since January 2019
Visitors: 2391