View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0225_low_10 (Length: 438)

Name: NF0225_low_10
Description: NF0225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0225_low_10
NF0225_low_10
[»] chr1 (1 HSPs)
chr1 (338-420)||(47552391-47552473)


Alignment Details
Target: chr1 (Bit Score: 79; Significance: 9e-37; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 338 - 420
Target Start/End: Complemental strand, 47552473 - 47552391
Alignment:
338 gagtcatcagtcaatgacatccaacgcactaacgcatattttttctgttcataagaagaagaaaaaactcttatatttttgtt 420  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
47552473 gagtcatcagtcaatgacatccaacgcactaacgcatattttttctgttcataagaagaagataaaactcttatatttttgtt 47552391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2375 times since January 2019
Visitors: 2400