View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0225_low_22 (Length: 342)
Name: NF0225_low_22
Description: NF0225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0225_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 10 - 294
Target Start/End: Complemental strand, 4293270 - 4292986
Alignment:
| Q |
10 |
ataattcttgtagacgctttaaacgttacttattgattgaattaatgttgtgcaagnnnnnnngtgtaaacaaggataatttttaccactattagaggaa |
109 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4293270 |
ataattcttgtaggcgctttaaacgttacttattgattgaattaatgttgtgcaagaaaaaaagtgtaaactaggataatttttaccactattagaggaa |
4293171 |
T |
 |
| Q |
110 |
atttaaacgatatctactagccgacacttaaaatacgtgatcttaattaaatcgtgtgatcataaactttgactgtatgctcttgttatctagccttctt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4293170 |
atttaaacgatatctactagccgacacttaaaatacgtgatcttaattaagtcgtgtgattataaactttgactgtgtgctcttgttatctagccttctt |
4293071 |
T |
 |
| Q |
210 |
ctaatttgcactcaatatatctaagtatagggggagatataggggtggctcattccggcaatagttgtctccaattttttaattt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4293070 |
ctaatttgcactcaatatatctaagtataggggcagatataggggtggctcattccggcaatagttgtctccaattttttaattt |
4292986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University