View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0225_low_24 (Length: 326)
Name: NF0225_low_24
Description: NF0225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0225_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 30 - 317
Target Start/End: Original strand, 48684300 - 48684587
Alignment:
Q |
30 |
catcagggctaggaccagagttgtcaatttccagtctcctaatgtttttattctgtttatgaccttccacaaccaaggagttcttcacaaccatattgtg |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48684300 |
catcagggctaggaccagagttgtcaatttccagtctcctaatgtttttattctgtttatgaccttccacaaccaaggagttcttcacaaccatattgtg |
48684399 |
T |
 |
Q |
130 |
tcgtgatttcataaagatactctcttttagttccaaggtgttcagtggccttgacatcccatattggatgcacaacaaggacaaagaaagaaaaataagg |
229 |
Q |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48684400 |
tggtgatttcataaagatactctcttttagttccaaggtgttcagtggccttgacatcccatattggatgcacaacaaggacaaagaaagaaaaataagg |
48684499 |
T |
 |
Q |
230 |
aagaagtttaagtattggtgttttccaaccatgactattgtagtatttaggtttggagatatgtatgattttggttattgagaataat |
317 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48684500 |
aagaagttaaagtattggtgttttccaaccatgactattgtagtatttaggtttggagatatgtatgattttggttattgagaataat |
48684587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1935 times since January 2019
Visitors: 2394