View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0225_low_26 (Length: 310)
Name: NF0225_low_26
Description: NF0225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0225_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 30 - 301
Target Start/End: Original strand, 1581007 - 1581286
Alignment:
| Q |
30 |
tcttcaagttgatgttcattgtaaagataatcatgacgattttgggaataaaacactaaaatataaggaagtttacagcttcagttttaagactaccttt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1581007 |
tcttcaagttgatgttcattgtaaagataatcatgacgattttgggaataaaacactaaaatataaggaagtttacagcttcagttttaagactaccttt |
1581106 |
T |
|
| Q |
130 |
cttctaccaaataaattatacttttgtagtgt--------ttcatggatttaaatattttgtcgtttatgatcaaaaacgagatgacgacgattgcgaga |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1581107 |
cttctaccaaataaattatacttttgtagtgtttcatggattcatggatttaaatattttgtcgtttatgatcaaaaacgagatgacgacgattgcgaga |
1581206 |
T |
|
| Q |
222 |
aagaatgtccttgggcgataaatgaatatggaccgtgtaaggagaagccaggaaatgttatagaatgttatcagtataat |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1581207 |
aagaatgtccttgggcgataaatgaatatggaccgtgtaaggagaagccaggaaatgttatagaatgttatcagtataat |
1581286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1694 times since January 2019
Visitors: 2393