View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0225_low_32 (Length: 298)
Name: NF0225_low_32
Description: NF0225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0225_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 9e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 28 - 178
Target Start/End: Original strand, 41472672 - 41472822
Alignment:
Q |
28 |
catcataatcaatcgattaatataaatgcaaacacattctcaaaatctaaacctctaaaacagaaagtcattctcaatgtctgaagttctaaagcataaa |
127 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
41472672 |
catcataatcaatcgattaatataaatgcaaacacattctcaatatctaaacctctaaaacagaaagtcgttctcaatgtctgaagttctaaagcataaa |
41472771 |
T |
 |
Q |
128 |
gtatcatggtttggtcctattcaccatatttgtcttagaaattagttaaag |
178 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
41472772 |
gtatcatggtttggtcctattcaccgtatttgtcttagaaattagttaaag |
41472822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University