View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0225_low_55 (Length: 223)
Name: NF0225_low_55
Description: NF0225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0225_low_55 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 7 - 223
Target Start/End: Original strand, 24231873 - 24232083
Alignment:
Q |
7 |
gtcccttactgcaataatcgccacattaaattttattgaattatgtacagnnnnnnnnnnnnnnnccttacaaaagagttaattgaaggggtgtgtacag |
106 |
Q |
|
|
|||||||||| |||||||| ||||||||||||||||||||||||||||| | |||||||||||||||||||||| ||||||||| |
|
|
T |
24231873 |
gtcccttacttcaataatcatcacattaaattttattgaattatgtacagttttttttttc----ctttacaaaagagttaattgaagg--tgtgtacag |
24231966 |
T |
 |
Q |
107 |
ttatcttggaaaataggataattgaaggtgtgttgttggaacaattacatgaaatagagtaaaatttatgatttctgctattggaagtagttggagctac |
206 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
24231967 |
ttatcttggaaaataggacaattgaaggtgtgttgttggaacaattacatgaaatagagtaaaatttatgatttctgctattggtagtagttggagctac |
24232066 |
T |
 |
Q |
207 |
cactagctagagtgacc |
223 |
Q |
|
|
||||||||||||||||| |
|
|
T |
24232067 |
cactagctagagtgacc |
24232083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University