View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0225_low_58 (Length: 215)

Name: NF0225_low_58
Description: NF0225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0225_low_58
NF0225_low_58
[»] chr1 (1 HSPs)
chr1 (1-109)||(47552365-47552473)


Alignment Details
Target: chr1 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 47552365 - 47552473
Alignment:
1 tatatatgagttgtgcgttgtacaaaaacaaaaatataagagttttttcttcttcttatgaacagaaaaaatatgcgttagtgcgttggatgtcattgac 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
47552365 tatatatgagttgtgcgttgtacaaaaacaaaaatataagagttttatcttcttcttatgaacagaaaaaatatgcgttagtgcgttggatgtcattgac 47552464  T
101 tgatgactc 109  Q
    |||||||||    
47552465 tgatgactc 47552473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2547 times since January 2019
Visitors: 2401