View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226-INSERTION-1 (Length: 102)
Name: NF0226-INSERTION-1
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226-INSERTION-1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 8e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 8e-46
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 40457315 - 40457215
Alignment:
| Q |
1 |
aattgtttgtgctgaggcaaatcgccaagaaggtatgcttggtagtgagtctttcgaggggtctgcccttgctgtcaagaagtatcctaaggaaggaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40457315 |
aattgtttgtgctgaggcaaatcgccaagaagctatgcttggtagtgagtctttcgaggggtctgcccttgctgtcaagaagtatcctaagaaaggaatt |
40457216 |
T |
|
| Q |
101 |
c |
101 |
Q |
| |
|
| |
|
|
| T |
40457215 |
c |
40457215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.0000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.0000000000005
Query Start/End: Original strand, 4 - 49
Target Start/End: Complemental strand, 56393357 - 56393312
Alignment:
| Q |
4 |
tgtttgtgctgaggcaaatcgccaagaaggtatgcttggtagtgag |
49 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
56393357 |
tgtttgtgctgaagcaaatcgccaagaagctatgcttggtagtgag |
56393312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.0000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.0000000000005
Query Start/End: Original strand, 4 - 49
Target Start/End: Complemental strand, 27517595 - 27517550
Alignment:
| Q |
4 |
tgtttgtgctgaggcaaatcgccaagaaggtatgcttggtagtgag |
49 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
27517595 |
tgtttgtgctgaagcaaatcgccaagaagctatgcttggtagtgag |
27517550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University