View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226-INSERTION-13 (Length: 146)
Name: NF0226-INSERTION-13
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226-INSERTION-13 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 3e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 3e-68
Query Start/End: Original strand, 4 - 146
Target Start/End: Complemental strand, 3546073 - 3545931
Alignment:
| Q |
4 |
actcaactttattaattttggatttaaataagaacagaaagatccatgaaccattggtatcccgtgctcctcttcgacatctatgtcattctttcttagt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3546073 |
actcaactttattaattttggatttaaataagaacagaaaaatccatgaaccattggtatcccgtgctcctcttcaacatctatgtcattctttcttagt |
3545974 |
T |
|
| Q |
104 |
cattttttcaaactctaacatcaaattacatattctcatttgg |
146 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3545973 |
cattttttcaaactctaacatcaaagtacatattctcatttgg |
3545931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University