View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226-INSERTION-2 (Length: 255)
Name: NF0226-INSERTION-2
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226-INSERTION-2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 3683069 - 3683299
Alignment:
| Q |
1 |
gagaggttgtttggctggttccatttgcatattcaaactgcaagaggagccgaaaaaggaatcaaccaagcttcatcctccctctcacggcggaggagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3683069 |
gagaggttgtttggctggttccatttgcatcttcaaactgcaagaggagccgaaaaaggaatcaaccaagcttcatcctccctctcacggcggaggagaa |
3683168 |
T |
|
| Q |
101 |
aaggtggtggcagccggcaactattggtggtagtggttgttgcaaccaaggttgaaaagnnnnnnnnnngtttacggtcgcgattgcatttgattgaaaa |
200 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |||| ||| |||| |
|
|
| T |
3683169 |
aaggtggtggtagccagcaactattggtggtagtggttgttgcaaccaaggttgataa---aaaaaaaagtttacggtcgcgattgtatttaattaaaaa |
3683265 |
T |
|
| Q |
201 |
ttctaatatcaaagattcagacgcgaccgtgatc |
234 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
3683266 |
ttctaatattaaagattcagacgcgaccgtgatc |
3683299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University