View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0226-INSERTION-4 (Length: 265)

Name: NF0226-INSERTION-4
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0226-INSERTION-4
NF0226-INSERTION-4
[»] chr1 (1 HSPs)
chr1 (92-239)||(666803-666951)


Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 92 - 239
Target Start/End: Complemental strand, 666951 - 666803
Alignment:
92 ccctatgattttaatcatataaacttataaagtataagtaaaaaatgcatcttgtcaaacatagtcataatgctaacacgtttgcatatacaaatcagtc 191  Q
    |||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||    
666951 ccctatgattttaatcatatgaacttataaagtataagtaaaaaatgtatcttgtcaaacatagtcataatgctaacacgtttgcatatacagatcagtc 666852  T
192 aacaagtgatggcaaagttcagt-catttccctttcaaataaaaaattc 239  Q
    ||||||| ||||||||||||||| |||||||||||||||||||||||||    
666851 aacaagtaatggcaaagttcagtccatttccctttcaaataaaaaattc 666803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University