View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226-INSERTION-4 (Length: 265)
Name: NF0226-INSERTION-4
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226-INSERTION-4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 92 - 239
Target Start/End: Complemental strand, 666951 - 666803
Alignment:
| Q |
92 |
ccctatgattttaatcatataaacttataaagtataagtaaaaaatgcatcttgtcaaacatagtcataatgctaacacgtttgcatatacaaatcagtc |
191 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
666951 |
ccctatgattttaatcatatgaacttataaagtataagtaaaaaatgtatcttgtcaaacatagtcataatgctaacacgtttgcatatacagatcagtc |
666852 |
T |
|
| Q |
192 |
aacaagtgatggcaaagttcagt-catttccctttcaaataaaaaattc |
239 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
666851 |
aacaagtaatggcaaagttcagtccatttccctttcaaataaaaaattc |
666803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University