View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226-INSERTION-8 (Length: 307)
Name: NF0226-INSERTION-8
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226-INSERTION-8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 29210556 - 29210250
Alignment:
| Q |
1 |
attgaataattcgaatgtgaatgatggaatgaataacaagtttaacctagttgatcagaattttgaacctaatttatgtaattcttctgcaatgccatcg |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29210556 |
attgaataatttgaatgtgaatgatggaatgaataacaagtttaacctagttgatcagaattttgaacctaatttatgtaattcttctgcaatgccatcg |
29210457 |
T |
|
| Q |
101 |
tcgggtttaggttcgggttctgtgttgtttcaaccttttgaagtgaataaaaaggatcaatttgtgtttcagagtaaaccagaagcttcggggacgaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29210456 |
tcgggtttaggttcgggttctgtgttgtttcaaccttttgaagtgaataaaaaggatcaatttgtgtttcagagtaaaccagaagcttcgggggcgaatt |
29210357 |
T |
|
| Q |
201 |
ttgttgagtttaaatcacatgggccgaagattggtggaaaagaagggaagctgaaggagaaaactgggaatatgaggatgaataaaagtagggtgaattt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29210356 |
ttgttgagtttaaatcacatgggccgaagattggtggaaaagaagggaagctgaaggagaaaactgggaatatgaggatgaataaaagtagggtgaattt |
29210257 |
T |
|
| Q |
301 |
gaagaat |
307 |
Q |
| |
|
||||||| |
|
|
| T |
29210256 |
gaagaat |
29210250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University