View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_high_23 (Length: 201)
Name: NF0226_high_23
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0226_high_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 107; Significance: 8e-54; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 11019341 - 11019227
Alignment:
Q |
1 |
tctctttaatatcctttccatggtccgattccatcaattccttaactctctcacccaactctgtgccactcacaaacctattttctgattggttcacttt |
100 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11019341 |
tctctttaatatcctttccacggtccgattccatcaactccttaactctctcacccaactctgtgccactcacaaacctattttctgattggttcacttt |
11019242 |
T |
 |
Q |
101 |
caaagccaccttcat |
115 |
Q |
|
|
||||||||||||||| |
|
|
T |
11019241 |
caaagccaccttcat |
11019227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 28 - 115
Target Start/End: Complemental strand, 11050430 - 11050343
Alignment:
Q |
28 |
attccatcaattccttaactctctcacccaactctgtgccactcacaaacctattttctgattggttcactttcaaagccaccttcat |
115 |
Q |
|
|
|||||||||| |||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
11050430 |
attccatcaactccttaactctctcacccaattctgcgccactcacaaacctattttctgattggttcacttttaaagccaccttcat |
11050343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 27 - 78
Target Start/End: Complemental strand, 11002934 - 11002883
Alignment:
Q |
27 |
gattccatcaattccttaactctctcacccaactctgtgccactcacaaacc |
78 |
Q |
|
|
||||||||||| |||||||||||||| |||||||| | ||||||||||||| |
|
|
T |
11002934 |
gattccatcaactccttaactctctcccccaactcatttccactcacaaacc |
11002883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University