View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_low_10 (Length: 389)
Name: NF0226_low_10
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 82 - 379
Target Start/End: Complemental strand, 49997418 - 49997121
Alignment:
| Q |
82 |
atggtaaatgggaagaaggttatcttcaagctaaccaagtattgccatcccagtattgaaacaaaagttgtttatgatacttctaagtcaacattttatt |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49997418 |
atggtaaatgggaagaaggttatcttcaagctaatcaagtattgccatcccaatattgaaacaaaagttgtttatgatacttctaagtcaacattttatt |
49997319 |
T |
 |
| Q |
182 |
gtgtgtgtagacattttgagtcttgtggcattcagtgttcgcatatttttcgtgcaatgatctttgagcatgtggatcatattccaagcagtttggtttt |
281 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49997318 |
gtgtgtgtagacattttgagtctcgtggcattccgtgttcgcatatttttcgtgcaatgatctttgagcatgtggatcatattccaagcaatttggtttt |
49997219 |
T |
 |
| Q |
282 |
gacacggtggactaagaatgctaagattgctttactgtcatcgaatttgatggatggaatgaactatgatgtagagttcgctcagtttgcagcctatg |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49997218 |
gacacggtggactaagaatgctaagattgctttactgtcatcgaatttgatggatggaatgaactatgatgtagagttcgctcagtttgcagcctatg |
49997121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 104; Significance: 9e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 82 - 204
Target Start/End: Original strand, 24803406 - 24803526
Alignment:
| Q |
82 |
atggtaaatgggaagaaggttatcttcaagctaaccaagtattgccatcccagtattgaaacaaaagttgtttatgatacttctaagtcaacattttatt |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24803406 |
atggtaaatgggaagaaggttatcttcaagctaaccaagtattgtcatcccaatattgaaacaaaagttgtttatgatacttctaagtcaacattttat- |
24803504 |
T |
 |
| Q |
182 |
gtgtgtgtagacattttgagtct |
204 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
24803505 |
-tgtgtgtagacattttgagtct |
24803526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 96; Significance: 6e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 82 - 185
Target Start/End: Complemental strand, 52658364 - 52658261
Alignment:
| Q |
82 |
atggtaaatgggaagaaggttatcttcaagctaaccaagtattgccatcccagtattgaaacaaaagttgtttatgatacttctaagtcaacattttatt |
181 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52658364 |
atggtaaatgggtagaaggttatcttcaagctaaccaagtattgccatcccaatattgaaacaaaagttgtttatgatacttctaagtcaacattttatt |
52658265 |
T |
 |
| Q |
182 |
gtgt |
185 |
Q |
| |
|
|||| |
|
|
| T |
52658264 |
gtgt |
52658261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University