View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_low_12 (Length: 346)
Name: NF0226_low_12
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 1e-87; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 73 - 264
Target Start/End: Original strand, 24216017 - 24216208
Alignment:
| Q |
73 |
gaaaacgaggcagaagttgttgatgcagagttggagagtggcggctgagtttgattgtctctgttcgatgtggaggccgatgatgggggaagggaaggag |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24216017 |
gaaaacgaggcagaagttgttgatgcagagttggagagtggcggctgagtttgattgactccgtttgatgtggaggccgatgatgggggaagggaaggag |
24216116 |
T |
|
| Q |
173 |
aggattagattttcgataaaccaggcatccacgtggtcaggagaagaagtgaggagggtttggattttttggtttgaatcgatgatgatgtc |
264 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
24216117 |
aggattaagttttcgataaaccaggcatccacgtggtcaggagaagaagtgaggagggtttggatttttcggtttgaatcgatggtgatgtc |
24216208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 75 - 264
Target Start/End: Original strand, 24210262 - 24210451
Alignment:
| Q |
75 |
aaacgaggcagaagttgttgatgcagagttggagagtggcggctgagtttgattgtctctgttcgatgtggaggccgatgatgggggaagggaaggagag |
174 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||| |||||||||||| | ||| |||| |||||||||||||||||||| |||| |||||| || |
|
|
| T |
24210262 |
aaacgaggcagaagttgttaatgcagagggtgagagtggctgctgagtttgatggactccgttcaatgtggaggccgatgatgggagaagagaaggaaag |
24210361 |
T |
|
| Q |
175 |
gattagattttcgataaaccaggcatccacgtggtcaggagaagaagtgaggagggtttggattttttggtttgaatcgatgatgatgtc |
264 |
Q |
| |
|
|||| ||| |||||||||| | |||||| ||||||||| || |||||||||||||||||| | | |||||| |||||| ||||||| |
|
|
| T |
24210362 |
gattctgtttacgataaaccaatcgtccacgaggtcaggagtggaggtgaggagggtttggattgtgtagtttgagtcgatggtgatgtc |
24210451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 140 - 264
Target Start/End: Original strand, 24217435 - 24217559
Alignment:
| Q |
140 |
atgtggaggccgatgatgggggaagggaaggagaggattagattttcgataaaccaggcatccacgtggtcaggagaagaagtgaggagggtttggattt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||| ||||||||||||||||| |||||||||| || ||||||||||||| ||||||||||| |
|
|
| T |
24217435 |
atgtggaggccgatgatgggggaagggacagggaggattaggttttcgataaaccaggcttccacgtggttagaggaagaagtgaggacggtttggattt |
24217534 |
T |
|
| Q |
240 |
tttggtttgaatcgatgatgatgtc |
264 |
Q |
| |
|
| |||||||||| ||| ||||||| |
|
|
| T |
24217535 |
tgcggtttgaatcaatggtgatgtc |
24217559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University