View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_low_13 (Length: 334)
Name: NF0226_low_13
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 246
Target Start/End: Complemental strand, 14696525 - 14696298
Alignment:
| Q |
19 |
taggcatatttgggagacgttctccattcggtttgaatgggtcccgaagtgctatgaacaccctcctatggggagagatgtgttaggagtaattgaacga |
118 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14696525 |
taggcatgtttgggagacgttctccattcgatttgaatggggcccgaagtgctattaacaccctcctgcggggagagatgtgttaggagtaattgaacga |
14696426 |
T |
|
| Q |
119 |
aatgcggaattggccttgttttggtttgggcctatgtaaatgagccttaatctactgctcggtcaagaacaaattccatctcaaattaggagacacttag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14696425 |
aatgcggaattggccttgttttggtttgggcctatgtaaatgagccttaatctactgctcggtccagaacaaattccatctcaaattaggagacacttag |
14696326 |
T |
|
| Q |
219 |
gtgtcatgaagtttatagagtcatacat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
14696325 |
gtgtcatgaagtttatagagtcatacat |
14696298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University