View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_low_16 (Length: 319)
Name: NF0226_low_16
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 91 - 247
Target Start/End: Original strand, 19344762 - 19344918
Alignment:
| Q |
91 |
attacttcccataaatgatgatttatcactcctgtttttggttaaacatatatagcattatggcattgaataggatgatggagttgaagttagacacggg |
190 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19344762 |
attacttcccataattgatgatttatcactcctgtttttggttaaacatatatagcattatggcattgaataggatgatggagttgaagttagacacggg |
19344861 |
T |
 |
| Q |
191 |
gcattaggtcttcgacagctggggatagcagcgacacactgtaaacttgagcctatg |
247 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19344862 |
gcattaggtcttcggcagctggggatagcagcgacacactgtaaacttgagcctatg |
19344918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University