View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_low_18 (Length: 318)
Name: NF0226_low_18
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0226_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 54; Significance: 5e-22; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 222 - 310
Target Start/End: Original strand, 31325644 - 31325730
Alignment:
Q |
222 |
aattaatgttcttcgtagaaatagtatctatattcaatatgtgtattctttttcgtgtaaactctgcattaaatacggctattcatctc |
310 |
Q |
|
|
|||||||||||||||||||| | |||||| ||||||||||||||||| ||||| ||||||||||| ||||| |||||||||||||||| |
|
|
T |
31325644 |
aattaatgttcttcgtagaagttgtatctgtattcaatatgtgtattttttttagtgtaaactct--attaattacggctattcatctc |
31325730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 111 - 187
Target Start/End: Original strand, 31325521 - 31325599
Alignment:
Q |
111 |
tagatgtagacccccttcccagctaggaattatgaaaaacacataaacgac--accaaattattgttcaaaaacagtaa |
187 |
Q |
|
|
|||||||||||||| |||||||||||||||| ||| ||||||| ||||||| | |||||||||||||||||||||||| |
|
|
T |
31325521 |
tagatgtagaccccattcccagctaggaattttgagaaacacacaaacgacataacaaattattgttcaaaaacagtaa |
31325599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 29 - 68
Target Start/End: Original strand, 31325376 - 31325415
Alignment:
Q |
29 |
aaattttgacacacattcaaaatcatctaatcaaaataag |
68 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31325376 |
aaattttgacacacattcaaaatcatctaatcaaaataag |
31325415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University