View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_low_2 (Length: 495)
Name: NF0226_low_2
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 30 - 391
Target Start/End: Original strand, 12881957 - 12882319
Alignment:
| Q |
30 |
gatggaatatgcggcgctacagaatatggcgggaattgttgatgggttgtggttgtgggaaaggatgaattgttgcagtgataggcctgagggtttgggg |
129 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12881957 |
gatggaatatgcggcgctgcagaatatggcgggaattgttgatgggttgtggttgtgggaaaggatgaattgttgcagtgataggcctgagggtttgggg |
12882056 |
T |
 |
| Q |
130 |
tttaggaaattgaatttgtgagagtagagtgattcgaaggtggagaaacatgttggtggaccaagaacaagtacttttggaagctctttggccattgaat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12882057 |
tttaggaaattgaatttgtgagagtagagtgattcgaaggtggagaaacatgttggtggaccaagaacaagtacttttggaaggtctttggccattgaat |
12882156 |
T |
 |
| Q |
230 |
tttaaggatttgtggtgtttgagaaagggatgaaattagcactctcatttggatgacactcaaaactgtggctagaaactcctcttaatta-ttctctgt |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12882157 |
tttaaggatttgtggtgtttgagaaagggatgaacttagcacttttatttggatgacactcaaaactgtggctagaaactcctcttaattatttctctgt |
12882256 |
T |
 |
| Q |
329 |
atcacttgtcttccatgaagcaccaacacgtcttagattagaagtattccggtgtcggataca |
391 |
Q |
| |
|
|||||||| |||||||||||| | |||| | ||||||||||| ||||| |||||||||||||| |
|
|
| T |
12882257 |
atcacttgacttccatgaagcgcgaacatgccttagattagacgtatttcggtgtcggataca |
12882319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University