View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_low_20 (Length: 316)
Name: NF0226_low_20
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0226_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 7e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 90 - 205
Target Start/End: Complemental strand, 54238564 - 54238453
Alignment:
Q |
90 |
ttacaggcacgaaaactttctcaccagtaatattatgttcttcatcaaatccaaccttcctattatttccttccttcccttcaaactcaattttctccaa |
189 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
54238564 |
ttacaggcacgaaaactttctcaccagtaatattatgttcttcatcaaatccaaccttcctattatttcc----ttcccttcaaactcaattttctccaa |
54238469 |
T |
 |
Q |
190 |
gaatcttgcatttgtg |
205 |
Q |
|
|
|||||||||||||||| |
|
|
T |
54238468 |
gaatcttgcatttgtg |
54238453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 25 - 68
Target Start/End: Complemental strand, 54238632 - 54238589
Alignment:
Q |
25 |
atactgtggcggaataataaattatgtgtgaatgctatataatc |
68 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54238632 |
atactgtggcggaataataaattatgtgtgaatgctatataatc |
54238589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University