View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_low_21 (Length: 314)
Name: NF0226_low_21
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226_low_21 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 93 - 314
Target Start/End: Original strand, 42851991 - 42852210
Alignment:
| Q |
93 |
cagttcggttcagttcaatagtttgattcagtttttggttttcatgcctacccctagtaataatatttgatttgatgagacttnnnnnnnntatcaatct |
192 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
42851991 |
cagttcggtacagttcaatagtttggttcagtttttggtttttatgcctacccctagtaataatatttgatttgatgagacttaaaaaa--tatctatct |
42852088 |
T |
|
| Q |
193 |
ttaatgactttctctcctctatgtggggtcattagtagaagtttcaacatgaatgaatcaattgttcgagtttgaactcatgatctccaactccttatct |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42852089 |
ttaatgactttctctcctctatgtggggtcattaggggaagtttcagcatgaatgaatcaattgttcgagtttgaactcatgatctccaacttcttatct |
42852188 |
T |
|
| Q |
293 |
attagtttaaatcagttaagtt |
314 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
42852189 |
attagtttaaatcagttgagtt |
42852210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 93 - 149
Target Start/End: Original strand, 52422608 - 52422664
Alignment:
| Q |
93 |
cagttcggttcagttcaatagtttgattcagtttttggttttcatgcctacccctag |
149 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||| ||||| |||||||| |
|
|
| T |
52422608 |
cagttcggttcagttcaatagtttggtttagtttttggtttttatgcccacccctag |
52422664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 93 - 148
Target Start/End: Original strand, 38256311 - 38256366
Alignment:
| Q |
93 |
cagttcggttcagttcaatagtttgattcagtttttggttttcatgcctaccccta |
148 |
Q |
| |
|
|||||||||| ||||||| |||||| |||||||||||||||| ||||| ||||||| |
|
|
| T |
38256311 |
cagttcggtttagttcaacagtttggttcagtttttggtttttatgcccaccccta |
38256366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 100 - 148
Target Start/End: Original strand, 16117476 - 16117524
Alignment:
| Q |
100 |
gttcagttcaatagtttgattcagtttttggttttcatgcctaccccta |
148 |
Q |
| |
|
||||||||||| | |||| |||||||||||||||| ||||| ||||||| |
|
|
| T |
16117476 |
gttcagttcaacaatttggttcagtttttggtttttatgcccaccccta |
16117524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 271 - 307
Target Start/End: Original strand, 3231503 - 3231539
Alignment:
| Q |
271 |
catgatctccaactccttatctattagtttaaatcag |
307 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
3231503 |
catgatctccaactccttatctcttagttcaaatcag |
3231539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University