View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_low_24 (Length: 310)
Name: NF0226_low_24
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 59 - 234
Target Start/End: Original strand, 44636061 - 44636236
Alignment:
| Q |
59 |
cacagacaaaaagttgcaagttttgcataaaaatatggggaaaaccccgtctatttgcagcagtaatctgattatttgtttgctccaatccatatatacg |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44636061 |
cacagacaaaaagttgcaagttttgcataaaaatatggggaaaaccccgtctatttgtagcagtaatctgattatttgtttgctccaatccatatatacg |
44636160 |
T |
|
| Q |
159 |
gtaataagatggagtatcatttcatgtgcatagcaaagtataactataacgtgatggatctcatgcaaaatagtta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44636161 |
gtaataagatggagtatcatttcatgtgcatagcaaagtataactataacgtgatggatctcatgcaaaatagtta |
44636236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University