View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_low_26 (Length: 307)
Name: NF0226_low_26
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226_low_26 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 204 - 307
Target Start/End: Complemental strand, 26890989 - 26890879
Alignment:
| Q |
204 |
agatcaaattaggtaacaattttannnnnnnggtgaaggtgtg-----tacaaacaagtgaagtgaaaatgaagcagttgac--aaaaacgaaatgagtg |
296 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26890989 |
agatcaaattaggtaacaattttatttttttggtgaaggtgtgtataatacaaacaagtgatgtgaaaatgaagcagttgacagaaaaacgaaatgagtg |
26890890 |
T |
 |
| Q |
297 |
acttaccttac |
307 |
Q |
| |
|
||||||||||| |
|
|
| T |
26890889 |
acttaccttac |
26890879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 74 - 118
Target Start/End: Complemental strand, 26891040 - 26890996
Alignment:
| Q |
74 |
catgcaaaattgttgtggtgctctaaggttctcatcatatttttc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26891040 |
catgcaaaattgttgtggtgctctaaggttctcatcatatttttc |
26890996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University