View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_low_27 (Length: 302)
Name: NF0226_low_27
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 78 - 221
Target Start/End: Complemental strand, 4355515 - 4355378
Alignment:
| Q |
78 |
tgtatagggtaagtatgcctattttggtacttgcccattaatttgtgtcatcccgagtaagcatggaaattttcttccttggcaatggcaaccaacttaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4355515 |
tgtatagggtaagtatgcctattttgttacttgcccattaatttgtgtcatcccgtgtaagcatggaaattttcttccttg------gcaaccaacttaa |
4355422 |
T |
|
| Q |
178 |
ttaagcaggagaaaagtgatatctttataaaagtcattgaatga |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4355421 |
ttaagcaggagaaaagtgatatctttataaaagtcattgaatga |
4355378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University