View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_low_28 (Length: 299)
Name: NF0226_low_28
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 60 - 289
Target Start/End: Original strand, 3711104 - 3711331
Alignment:
| Q |
60 |
tatctacaactatctgaaaagacaattgttcaagattggattttggggtccattaaaccataatccacccactctaaagactaactagcaacattttcca |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3711104 |
tatctacaactatctgaaaagacaattgttcaagattggattttggggtccattaaaccataatccacccactctaaagactaactagcaacattttcta |
3711203 |
T |
|
| Q |
160 |
aggaacacactttctaacctnnnnnnncctctcgcttacacacttactgacttgaatatatgagtgtttgtaggtaca-ccccacctctagggctgatga |
258 |
Q |
| |
|
||| |||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||| |
|
|
| T |
3711204 |
aggtacacactttctaacctaaaaaaacctctcgcctacacacttactgacttgaatatatgagtgtttgtaggtacacccccacctcaagggc---tga |
3711300 |
T |
|
| Q |
259 |
tgacgtgggtatgtccaaccattaccctatg |
289 |
Q |
| |
|
|||||||||||| |||||||| |||| |||| |
|
|
| T |
3711301 |
tgacgtgggtatatccaaccactaccatatg |
3711331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University