View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_low_29 (Length: 299)
Name: NF0226_low_29
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0226_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 53 - 230
Target Start/End: Complemental strand, 18464648 - 18464471
Alignment:
Q |
53 |
agcagagattcggcgtgtcctggagattgcatctgctgctaaagttgaggctgcaaattacttcctgatgatgttggatgcttctgctgcaggaggtctt |
152 |
Q |
|
|
||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
T |
18464648 |
agcagagattcggcgggtcctagagattgcatctgctgctaaagttgaggctgcaaattacttcctgatgatgttggatgcttctgatgtaggaggtctt |
18464549 |
T |
 |
Q |
153 |
gagattgaaagagcaatctctactttcaccaggttttttagggctcagaagcttggagaacttcgactgtgcatggtg |
230 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18464548 |
gagattgaaagagcaatctctactttcaccaggttttttagggctcagaagcttggagaacttcgactgtgcatggtg |
18464471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 76 - 148
Target Start/End: Complemental strand, 16190043 - 16189971
Alignment:
Q |
76 |
agattgcatctgctgctaaagttgaggctgcaaattacttcctgatgatgttggatgcttctgctgcaggagg |
148 |
Q |
|
|
||||||||| |||||||||| || |||||| |||||||| ||||| || | ||||||||||||| |||||| |
|
|
T |
16190043 |
agattgcatatgctgctaaaaccgaagctgcagattacttcttgatgttgctagatgcttctgctgaaggagg |
16189971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 78 - 206
Target Start/End: Complemental strand, 16601787 - 16601659
Alignment:
Q |
78 |
attgcatctgctgctaaagttgaggctgcaaattacttcctgatgatgttggatgcttctgctgcaggaggtcttgagattgaaagagcaatctctactt |
177 |
Q |
|
|
||||||||||||||| |||||| |||||||||| ||| ||||||||||||||| ||| ||| || | ||| || |||||||||| | ||||| | |
|
|
T |
16601787 |
attgcatctgctgctggtgttgagtctgcaaattatttcttgatgatgttggatgtttcggctacaagtggttttctagttgaaagagctgtttctacct |
16601688 |
T |
 |
Q |
178 |
tcaccaggttttttagggctcagaagctt |
206 |
Q |
|
|
|||| || ||||||||| |||| |||||| |
|
|
T |
16601687 |
tcacaagattttttaggactcaaaagctt |
16601659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University