View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_low_31 (Length: 296)
Name: NF0226_low_31
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 31 - 277
Target Start/End: Complemental strand, 53120604 - 53120358
Alignment:
| Q |
31 |
tgatatccacatgtatttcgttaaataaaatagagttttaaaaagataatgttactagcattccgttttatatagccaccattaagatccacttaggata |
130 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
53120604 |
tgatatccacatagatttcgctcaataaaatagagttttaaaaagataatgttactagcattccgttttatctagccaccattaagatccacttaggata |
53120505 |
T |
 |
| Q |
131 |
aaatttgttctcatataaaaccttttctttgtaataaatctaatactacaagttaattaccacttaatactaattatcccaatagaagtaaactgttatt |
230 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
53120504 |
aaatttgttctcatgtaaaaccttttctttgtaataaatctaatactacaagttaattaccacttaatactaattatcccaataaaagtaaactcttatt |
53120405 |
T |
 |
| Q |
231 |
atgaacaaactttacttattatatatcgggcatttcataactcctta |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
53120404 |
atgaacaaactttacttattatatatcgggcatttcattactcctta |
53120358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University