View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_low_41 (Length: 258)
Name: NF0226_low_41
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 47 - 250
Target Start/End: Complemental strand, 42797791 - 42797601
Alignment:
| Q |
47 |
taattattttggaagttacgttgttttaatatgtatagggaaatggattgaatattttggtgaaggttagataaaactgcttctaaatgacacatcttat |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42797791 |
taattattttggaagttacgttgttttaatatgtatagggaaatggattgaatattttggtgaaggttagataaaactgcttctaaatgacacatcttat |
42797692 |
T |
|
| Q |
147 |
cttccaaagaagtttttgatagttcaatatccttgttcaattttaccaattcgttggaatacattttctttctctatttgcaggctcaccctttgtttca |
246 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42797691 |
cttccaaagaagtttttgatagtt-------------caattctaccaattcgttggaatacattttctttctctatttgcaggctcaccctttgtttct |
42797605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 42798204 - 42798152
Alignment:
| Q |
1 |
aactcatattatcaaacggtttcttgatttagcatatagttgataataattat |
53 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42798204 |
aactcatattatcaaatggtttcttgatttagcatatagttgataataattat |
42798152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University