View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_low_43 (Length: 257)
Name: NF0226_low_43
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 42798220 - 42798446
Alignment:
| Q |
1 |
tttgaaggtttaattttta-tttaatttaatatcttaaaactgatccaatttctatttgatttgtatgaatgctctcttttgtcgattctgtgtagaaat |
99 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42798220 |
tttgaaggtttaatttttaatttaatttaatatcttaaaactgatccaatttctatttaatttgtatgaatgctct--tttgtcgattctgtgtagaaat |
42798317 |
T |
 |
| Q |
100 |
agcttatatttgggaagcttgtatgaatcacagattaaaatttagcagacatgatagaatcacatattaatattggaacatgttactactttgtcaacat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42798318 |
agcttatatttgggaagcttgtatgaatcacagattaaaatttagcagacatgatagaatcacatattaatattggaagatgttactactttgtcaacat |
42798417 |
T |
 |
| Q |
200 |
tgtagttaatgtagttataagttcattta |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42798418 |
tgtagttaatgtagttataagttcattta |
42798446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University