View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_low_50 (Length: 226)
Name: NF0226_low_50
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226_low_50 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 10 - 139
Target Start/End: Original strand, 6351924 - 6352053
Alignment:
| Q |
10 |
aagaaaatacaaaggtgtagctaaaatgtgatggctcaggagtagggctccgtaattttgtgtgaattacttcaaataatttagaatgaatagtaatgga |
109 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6351924 |
aagaatatacaaaggtgtaactaaaatgtgatggctcaggagtagggctccgtaattttgtgtgaattacttcaaataatttagaatgaatagtaatgga |
6352023 |
T |
|
| Q |
110 |
aagtggagtatgtaatcgatgtgatttacc |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6352024 |
aagtggagtatgtaatcgatgtgatttacc |
6352053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University