View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| ||||||||||||||||
Alignment Overview
Query: NF0226_low_55 (Length: 210)
Name: NF0226_low_55
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| |||||
| ||||||
| ||||||
Alignment Details
Target: chr7 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 7 - 108
Target Start/End: Complemental strand, 49170996 - 49170895
Alignment:
| Q | 7 | aaaaagataaatttgtgattatactctttggcatgtggtcctttctttactatctgtaaacaacaaagttttagagacaaccaagcccttactatattct | 106 | Q |
| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| | ||||
| T | 49170996 | aaaaacataaatttgtgattatactctttggcatgtggtcctttctttactatctgcaaacaacaaagttttagagacaaccaagcccttattatattct | 49170897 | T |
 | ||||
| Q | 107 | tg | 108 | Q |
| || | ||||
| T | 49170896 | tg | 49170895 | T |
| ||||
Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 8421112 - 8421219
Alignment:
| Q | 1 | gaaaagaaaaagataaatttgtgattatactctttggcatgtggtcctttctttactatctgtaaacaacaaagttttagagacaaccaagcccttacta | 100 | Q |
| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| | ||||
| T | 8421112 | gaaaagaaaaacataaatttgtgattatactctttggcatgtggtcctttctttactatctgcaaacaacaaagttttagagacaaccaagaccttactc | 8421211 | T |
| ||||
| Q | 101 | tattcttg | 108 | Q |
| ||||||| | ||||
| T | 8421212 | aattcttg | 8421219 | T |
| ||||
Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University