View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_low_55 (Length: 210)
Name: NF0226_low_55
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226_low_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 7 - 108
Target Start/End: Complemental strand, 49170996 - 49170895
Alignment:
| Q |
7 |
aaaaagataaatttgtgattatactctttggcatgtggtcctttctttactatctgtaaacaacaaagttttagagacaaccaagcccttactatattct |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49170996 |
aaaaacataaatttgtgattatactctttggcatgtggtcctttctttactatctgcaaacaacaaagttttagagacaaccaagcccttattatattct |
49170897 |
T |
 |
| Q |
107 |
tg |
108 |
Q |
| |
|
|| |
|
|
| T |
49170896 |
tg |
49170895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 8421112 - 8421219
Alignment:
| Q |
1 |
gaaaagaaaaagataaatttgtgattatactctttggcatgtggtcctttctttactatctgtaaacaacaaagttttagagacaaccaagcccttacta |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8421112 |
gaaaagaaaaacataaatttgtgattatactctttggcatgtggtcctttctttactatctgcaaacaacaaagttttagagacaaccaagaccttactc |
8421211 |
T |
 |
| Q |
101 |
tattcttg |
108 |
Q |
| |
|
||||||| |
|
|
| T |
8421212 |
aattcttg |
8421219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University