View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_low_58 (Length: 202)
Name: NF0226_low_58
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0226_low_58 |
 |  |
|
[»] scaffold0554 (1 HSPs) |
 |  |  |
|
[»] scaffold0059 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 4e-49; HSPs: 11)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 4e-49
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 23036237 - 23036335
Alignment:
Q |
1 |
tctcgggataaaatctctctggttcagtccagtaatttggatctcttgcaattgcccaagcatttattgttaccttactcttaataggtatgtgataac |
99 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23036237 |
tctcgggataaaatctctctggttcagtccagtaatttggatctcttgcaattgcccaagcatttattgttaccttactcttaataggtatgtgataac |
23036335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 23039108 - 23039206
Alignment:
Q |
1 |
tctcgggataaaatctctctggttcagtccagtaatttggatctcttgcaattgcccaagcatttattgttaccttactcttaataggtatgtgataac |
99 |
Q |
|
|
|||| |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| | | | |||||||||||||||||||||||||||| |
|
|
T |
23039108 |
tctctggataaaatctctccggctcagtccagtaatttggatctcttgcaattgcccaagcattgactatcaccttactcttaataggtatgtgataac |
23039206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 60; E-Value: 8e-26
Query Start/End: Original strand, 12 - 99
Target Start/End: Original strand, 23032777 - 23032864
Alignment:
Q |
12 |
aatctctctggttcagtccagtaatttggatctcttgcaattgcccaagcatttattgttaccttactcttaataggtatgtgataac |
99 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| | | | |||||||| ||||| ||||||||||||| |
|
|
T |
23032777 |
aatctctctggttcagtccagtagtttggatctcttgcaattgcccaagcattgactatcaccttacttttaattggtatgtgataac |
23032864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 23017129 - 23017227
Alignment:
Q |
1 |
tctcgggataaaatctctctggttcagtccagtaatttggatctcttgcaattgcccaagcatttattgttaccttactcttaataggtatgtgataac |
99 |
Q |
|
|
|||| |||||||| ||||||||||||||||||| |||||||||||||| |||||||||||||| ||| | |||||| |||||| ||||||||||||| |
|
|
T |
23017129 |
tctctggataaaacttctctggttcagtccagtagtttggatctcttgcgattgcccaagcattaattatcaccttagtcttaactggtatgtgataac |
23017227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 23145987 - 23146085
Alignment:
Q |
1 |
tctcgggataaaatctctctggttcagtccagtaatttggatctcttgcaattgcccaagcatttattgttaccttactcttaataggtatgtgataac |
99 |
Q |
|
|
|||| |||||||| |||||||||||||||||||| |||||||||||||||| |||||||||||| | | |||||| ||||||| ||||||||||||| |
|
|
T |
23145987 |
tctctggataaaacctctctggttcagtccagtagtttggatctcttgcaactgcccaagcattgactaacaccttagtcttaatcggtatgtgataac |
23146085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 23148825 - 23148923
Alignment:
Q |
1 |
tctcgggataaaatctctctggttcagtccagtaatttggatctcttgcaattgcccaagcatttattgttaccttactcttaataggtatgtgataac |
99 |
Q |
|
|
|||| |||||||| |||||||||||||||||||| |||| |||||||||||||||||||||||| ||| | || ||| ||||||| || |||||||||| |
|
|
T |
23148825 |
tctctggataaaacctctctggttcagtccagtagtttgaatctcttgcaattgcccaagcattgattatcactttagtcttaatcggaatgtgataac |
23148923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 23024339 - 23024402
Alignment:
Q |
1 |
tctcgggataaaatctctctggttcagtccagtaatttggatctcttgcaattgcccaagcatt |
64 |
Q |
|
|
|||| |||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
23024339 |
tctctggataaaacctctctggttcggtccagtaatttggatctcttgcaattgcccaagcatt |
23024402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 23140113 - 23140176
Alignment:
Q |
1 |
tctcgggataaaatctctctggttcagtccagtaatttggatctcttgcaattgcccaagcatt |
64 |
Q |
|
|
|||| ||||||||| ||||||||||||||||||| ||||||||||| || |||||||| ||||| |
|
|
T |
23140113 |
tctctggataaaatttctctggttcagtccagtagtttggatctctcgcgattgcccatgcatt |
23140176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 99
Target Start/End: Original strand, 22946488 - 22946569
Alignment:
Q |
18 |
tctggttcagtccagtaatttggatctcttgcaattgcccaagcatttattgttaccttactcttaataggtatgtgataac |
99 |
Q |
|
|
||||| |||||||| || |||||||| ||| |||||||||||||||| ||| | ||| |||| || || ||||||||||||| |
|
|
T |
22946488 |
tctggatcagtccaatattttggatcccttccaattgcccaagcattgattatcaccctactattgattggtatgtgataac |
22946569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 99
Target Start/End: Original strand, 22972035 - 22972116
Alignment:
Q |
18 |
tctggttcagtccagtaatttggatctcttgcaattgcccaagcatttattgttaccttactcttaataggtatgtgataac |
99 |
Q |
|
|
||||| |||||||| || |||||||| ||| |||||||||||||||| ||| | ||| |||| || || ||||||||||||| |
|
|
T |
22972035 |
tctggatcagtccaatattttggatcccttccaattgcccaagcattgattatcaccctacttttgattggtatgtgataac |
22972116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 64
Target Start/End: Complemental strand, 22941502 - 22941444
Alignment:
Q |
6 |
ggataaaatctctctggttcagtccagtaatttggatctcttgcaattgcccaagcatt |
64 |
Q |
|
|
||||||||||||||||| ||| ||| | ||||||||||||| |||| ||||||||||| |
|
|
T |
22941502 |
ggataaaatctctctgggtcatcccaatgatttggatctcttccaatggcccaagcatt |
22941444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0554 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: scaffold0554
Description:
Target: scaffold0554; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 6687 - 6589
Alignment:
Q |
1 |
tctcgggataaaatctctctggttcagtccagtaatttggatctcttgcaattgcccaagcatttattgttaccttactcttaataggtatgtgataac |
99 |
Q |
|
|
|||| |||||||| |||||||||||||||||| | ||||||||||||||||||||||||||||| ||| | ||||||||| ||| ||||||| ||||| |
|
|
T |
6687 |
tctctggataaaacctctctggttcagtccagaagtttggatctcttgcaattgcccaagcattgattatcaccttactcctaaacggtatgttataac |
6589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 21779880 - 21779978
Alignment:
Q |
1 |
tctcgggataaaatctctctggttcagtccagtaatttggatctcttgcaattgcccaagcatttattgttaccttactcttaataggtatgtgataac |
99 |
Q |
|
|
|||| |||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| ||| | |||||| ||||||| || ||||| |||| |
|
|
T |
21779880 |
tctctggataaaacatctctggttcagtccagtagtttggatctcttgcaattgcccaagcattgattatcaccttagtcttaatcggaatgtggtaac |
21779978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 12609972 - 12610035
Alignment:
Q |
1 |
tctcgggataaaatctctctggttcagtccagtaatttggatctcttgcaattgcccaagcatt |
64 |
Q |
|
|
|||| |||||||| ||||||||||||||||||| |||||||||||| |||| ||||| ||||| |
|
|
T |
12609972 |
tctccggataaaacttctctggttcagtccagtactttggatctcttccaatcgcccatgcatt |
12610035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 15885895 - 15885832
Alignment:
Q |
1 |
tctcgggataaaatctctctggttcagtccagtaatttggatctcttgcaattgcccaagcatt |
64 |
Q |
|
|
|||| |||||||| ||||||||||||||||| || |||||||||||| |||| ||||| ||||| |
|
|
T |
15885895 |
tctctggataaaacctctctggttcagtccaatactttggatctcttccaatcgcccatgcatt |
15885832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 12637068 - 12637146
Alignment:
Q |
1 |
tctcgggataaaatctctctggttcagtccagtaatttggatctcttgcaattgcccaagcatttattgttaccttact |
79 |
Q |
|
|
|||| |||| ||| |||||||||||||||||||| ||||||||||| |||||| ||| ||||||| | | |||||||| |
|
|
T |
12637068 |
tctctggatgaaacctctctggttcagtccagtactttggatctctaccaattgtccatgcatttactatcaccttact |
12637146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0059 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: scaffold0059
Description:
Target: scaffold0059; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 62220 - 62283
Alignment:
Q |
1 |
tctcgggataaaatctctctggttcagtccagtaatttggatctcttgcaattgcccaagcatt |
64 |
Q |
|
|
|||| |||||||| ||||||||||| |||||||| ||||||||||| | |||||||| ||||| |
|
|
T |
62220 |
tctctggataaaacctctctggttccgtccagtaccttggatctcttccgattgcccatgcatt |
62283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University