View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0226_low_60 (Length: 201)

Name: NF0226_low_60
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0226_low_60
NF0226_low_60
[»] chr6 (2 HSPs)
chr6 (13-97)||(11050437-11050521)
chr6 (28-97)||(11019438-11019507)


Alignment Details
Target: chr6 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 13 - 97
Target Start/End: Original strand, 11050437 - 11050521
Alignment:
13 gatattaaagagaggatgcttcttggaatagtttatcaccaaattcccctttccttcttcgttgaaaattagaaatagatcttta 97  Q
    |||||||||||||||||||||||||||||||||||||| |||||| | ||||||||||||||||||||||| |||||||||||||    
11050437 gatattaaagagaggatgcttcttggaatagtttatcatcaaatttcactttccttcttcgttgaaaattaaaaatagatcttta 11050521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 28 - 97
Target Start/End: Original strand, 11019438 - 11019507
Alignment:
28 atgcttcttggaatagtttatcaccaaattcccctttccttcttcgttgaaaattagaaatagatcttta 97  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
11019438 atgcttcttggaatagtttatcaccaaattcccctttccttcttcgttgaaaattaaaaatagatcttta 11019507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University