View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0226_low_60 (Length: 201)
Name: NF0226_low_60
Description: NF0226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0226_low_60 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 13 - 97
Target Start/End: Original strand, 11050437 - 11050521
Alignment:
| Q |
13 |
gatattaaagagaggatgcttcttggaatagtttatcaccaaattcccctttccttcttcgttgaaaattagaaatagatcttta |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| | ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11050437 |
gatattaaagagaggatgcttcttggaatagtttatcatcaaatttcactttccttcttcgttgaaaattaaaaatagatcttta |
11050521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 28 - 97
Target Start/End: Original strand, 11019438 - 11019507
Alignment:
| Q |
28 |
atgcttcttggaatagtttatcaccaaattcccctttccttcttcgttgaaaattagaaatagatcttta |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11019438 |
atgcttcttggaatagtttatcaccaaattcccctttccttcttcgttgaaaattaaaaatagatcttta |
11019507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University