View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0227-INSERTION-16 (Length: 109)
Name: NF0227-INSERTION-16
Description: NF0227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0227-INSERTION-16 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 1e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 35 - 109
Target Start/End: Original strand, 56313145 - 56313219
Alignment:
| Q |
35 |
tctcgcatacatacatacacatgtactatttcatgcatgaatttttaaattctgaccacaaattaattaattcct |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
56313145 |
tctcgcatacatacatacacatgtactatttcatgcatgaattttaaaattctgaccacaaattaattaattcct |
56313219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1675 times since January 2019
Visitors: 2392