View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0227-INSERTION-24 (Length: 68)
Name: NF0227-INSERTION-24
Description: NF0227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0227-INSERTION-24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 57; Significance: 1e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 1e-24
Query Start/End: Original strand, 7 - 67
Target Start/End: Original strand, 54220864 - 54220924
Alignment:
| Q |
7 |
acacaatagttgaaggaatgcgagtgggtggaaaggtgatcgaaacacccctcttgatttt |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
54220864 |
acacaatagttgaaggaatgcgagtgggtggaaaggtgatcgaaacaccccttttgatttt |
54220924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1793 times since January 2019
Visitors: 2393