View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0227-Insertion-18 (Length: 82)
Name: NF0227-Insertion-18
Description: NF0227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0227-Insertion-18 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 2e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 2e-33
Query Start/End: Original strand, 7 - 82
Target Start/End: Complemental strand, 3711041 - 3710966
Alignment:
| Q |
7 |
atgtcattgttccattattgctctagaatgaatcagacgatacatgttccatcaatggtcctgaccactccatctt |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3711041 |
atgtcattgttccattattgctctagaatgaatcagacgatacctgttccatcaatggtcctgaccactccatctt |
3710966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1943 times since January 2019
Visitors: 2394