View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0227_high_1 (Length: 488)
Name: NF0227_high_1
Description: NF0227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0227_high_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 1e-69; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 29 - 179
Target Start/End: Complemental strand, 16871408 - 16871256
Alignment:
| Q |
29 |
agaaacagtcaaatgcatgaataaga--tgctgtgttgttttgaagaacatccagatgatgaagcttgagaaagatgtccatgagtctacaatttcttct |
126 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16871408 |
agaaacagtcaaatgcattaataagagatgctgtgttgttttgaagaacatccagatgatgatgcttgagaaagatgtccatgagtctacaatttcttct |
16871309 |
T |
|
| Q |
127 |
gctacatcaaaataattggatttaggtacaaatcactaacttcctattaatta |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16871308 |
gctacatcaaaataattggatttaggtacaaatcactaacttcctattaatta |
16871256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 111; E-Value: 8e-56
Query Start/End: Original strand, 63 - 185
Target Start/End: Original strand, 16654942 - 16655064
Alignment:
| Q |
63 |
tgttttgaagaacatccagatgatgaagcttgagaaagatgtccatgagtctacaatttcttctgctacatcaaaataattggatttaggtacaaatcac |
162 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16654942 |
tgttgtgaagaacatccagatgatgaagcttgagaaagatgtccatgagtctacaatttcttctgctacatcaaaataattggatttaggtacaaatcac |
16655041 |
T |
|
| Q |
163 |
taacttcctattaattaaacaac |
185 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
16655042 |
taacttccatttaattaaacaac |
16655064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 219 - 258
Target Start/End: Complemental strand, 16871206 - 16871167
Alignment:
| Q |
219 |
tataaaatacagtaaaaggaaatgaaactatgtctatcat |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16871206 |
tataaaatacagtaaaaggaaatgaaactatgtcgatcat |
16871167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1887 times since January 2019
Visitors: 2394