View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0227_low_10 (Length: 357)

Name: NF0227_low_10
Description: NF0227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0227_low_10
NF0227_low_10
[»] chr2 (1 HSPs)
chr2 (3-110)||(24169568-24169677)
[»] chr7 (1 HSPs)
chr7 (3-91)||(11583737-11583827)


Alignment Details
Target: chr2 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 3 - 110
Target Start/End: Original strand, 24169568 - 24169677
Alignment:
3 ctcaaaatgcttccattcaagatatgtg--agtcaattcaaaagtggaatgatcttggggtgaacgccgatatcttttatgcctcatcttgtcctaaaaa 100  Q
    |||||||||||||||||||||||||| |  ||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||||||||||    
24169568 ctcaaaatgcttccattcaagatatgcgggagtcaattcaaaagtggaatgatcttggggtgaaccccgatatcttttatgccttaccttgtcctaaaaa 24169667  T
101 taccacaccg 110  Q
    ||||||||||    
24169668 taccacaccg 24169677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 3 - 91
Target Start/End: Complemental strand, 11583827 - 11583737
Alignment:
3 ctcaaaatgcttccattcaagatatgtg--agtcaattcaaaagtggaatgatcttggggtgaacgccgatatcttttatgcctcatcttg 91  Q
    |||||||||| ||||||||||||||| |  |||| |||||||||||||||||||||||||||||| |||||| ||||| ||||||| ||||    
11583827 ctcaaaatgcatccattcaagatatgcgggagtccattcaaaagtggaatgatcttggggtgaacaccgataccttttttgcctcaccttg 11583737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2133 times since January 2019
Visitors: 2399