View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0227_low_10 (Length: 357)
Name: NF0227_low_10
Description: NF0227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0227_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 3 - 110
Target Start/End: Original strand, 24169568 - 24169677
Alignment:
Q |
3 |
ctcaaaatgcttccattcaagatatgtg--agtcaattcaaaagtggaatgatcttggggtgaacgccgatatcttttatgcctcatcttgtcctaaaaa |
100 |
Q |
|
|
|||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |||||||||||||||||| | ||||||||||||| |
|
|
T |
24169568 |
ctcaaaatgcttccattcaagatatgcgggagtcaattcaaaagtggaatgatcttggggtgaaccccgatatcttttatgccttaccttgtcctaaaaa |
24169667 |
T |
 |
Q |
101 |
taccacaccg |
110 |
Q |
|
|
|||||||||| |
|
|
T |
24169668 |
taccacaccg |
24169677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 3 - 91
Target Start/End: Complemental strand, 11583827 - 11583737
Alignment:
Q |
3 |
ctcaaaatgcttccattcaagatatgtg--agtcaattcaaaagtggaatgatcttggggtgaacgccgatatcttttatgcctcatcttg |
91 |
Q |
|
|
|||||||||| ||||||||||||||| | |||| |||||||||||||||||||||||||||||| |||||| ||||| ||||||| |||| |
|
|
T |
11583827 |
ctcaaaatgcatccattcaagatatgcgggagtccattcaaaagtggaatgatcttggggtgaacaccgataccttttttgcctcaccttg |
11583737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2133 times since January 2019
Visitors: 2399