View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0227_low_14 (Length: 288)
Name: NF0227_low_14
Description: NF0227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0227_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 12 - 259
Target Start/End: Original strand, 10680196 - 10680443
Alignment:
| Q |
12 |
atgaagaaaacactgtcttggtgggacttgatatggtttggcatgggaagtgtcattggttcgggtatttttgtactaacaggacttgaagttaagaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10680196 |
atgaagaaaacactgtcttggtgggacttgatatggtttggcatgggaagtgtcattggttcaggtatttttgtactaacaggacttgaagttaagaaca |
10680295 |
T |
 |
| Q |
112 |
ctgtgggacctgctgtggttttatcatatattgtctcgggaatttcagctatgttgtctgttttttgttacactgaatttgctgtggaaatccctgtggc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10680296 |
ctgtgggacctgctgtggttttatcatatattgtctcgggcatttctgctatgttgtctgttttttgttacactgaatttgctgtggaaatccctgtggc |
10680395 |
T |
 |
| Q |
212 |
tggtacgtaattttttgtatgttatttgttcaagtctcttttagcaac |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10680396 |
tggtacgtaattttttgtatgttatttgttcaagtctcttttagcaac |
10680443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 37135622 - 37135667
Alignment:
| Q |
163 |
tgttgtctgttttttgttacactgaatttgctgtggaaatccctgt |
208 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| |||||||| ||||| |
|
|
| T |
37135622 |
tgttgtctgttttttgctacaccgaatttgcagtggaaattcctgt |
37135667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 37113634 - 37113542
Alignment:
| Q |
8 |
tgagatgaagaaaacactgtcttggtgggacttgatatggtttggcatgggaagtgtcattggttcgggtatttttgtactaacaggacttga |
100 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||| ||||| || ||||| ||||||||||| || || ||||| || || |||||||| |
|
|
| T |
37113634 |
tgagatgaagaagacactgaattggtgggacttgatgtggttcggtatgggcgccgtcattggttctggaatatttgtgcttaccggacttga |
37113542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University