View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0227_low_19 (Length: 252)
Name: NF0227_low_19
Description: NF0227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0227_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 32091309 - 32091069
Alignment:
Q |
1 |
aagagtaataatgggctaattgtgctggggaaatggaagaaattgttaaa-gatttttagggtcggaatattttagctccaccttcatcaaagagttttg |
99 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
32091309 |
aagagtaataatgggctgattgtgctggggaaatggaagaaattgttaaaagatttttagggtcggaatgttttagctccaccttcatcaaagagttttg |
32091210 |
T |
 |
Q |
100 |
ggatgtaatgaaatggaaggtaaaatatatgtttgatcactttcatgtgaat--gtgtctttccaatagtannnnnnngtttcctacttcattactttga |
197 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
32091209 |
ggatgtaatgaaatggaaggtaaaatatatgtttgatcgctttcatgtgaatgtgtgtctttccaatagtattttt---tttcctacttcattactttga |
32091113 |
T |
 |
Q |
198 |
ttttaaaggtgcattcccccaatatcatggagtcatcgtttcat |
241 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32091112 |
ttttaaaggtgcattcccccaatatcatggagtcatcgtttcat |
32091069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University