View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0227_low_3 (Length: 486)

Name: NF0227_low_3
Description: NF0227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0227_low_3
NF0227_low_3
[»] chr1 (1 HSPs)
chr1 (209-463)||(6299928-6300182)


Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 209 - 463
Target Start/End: Complemental strand, 6300182 - 6299928
Alignment:
209 caggatattttgaaagcaatttcatcgagacaaaagtgggatttaaacgatgttcgagttttcaacttcgatgttgctaaaatcagattcggaacttctc 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6300182 caggatattttgaaagcaatttcatcgagacaaaagtgggatttaaacgatgttcgagttttcaacttcgatgttgctaaaatcagattcggaacttctc 6300083  T
309 aaaactaccaatttcgaatcggctcgagtaagaacaatttcaccgtcaaattttcagatgaaatttcatcttggaatcacaacaagttcacaacaacacc 408  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6300082 aaaactacctatttcgaatcggctcgagtaagaacaatttcaccgtcaaattttcagatgaaatttcatcttggaatcacaacaagttcacaacaacacc 6299983  T
409 aaaaccagatttagcttctcttgttgatcaactcagttctattgcttttcttgat 463  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6299982 aaaaccagatttagcttctcttgttgatcaactcagttctattgcttttcttgat 6299928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1570 times since January 2019
Visitors: 2392