View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0227_low_4 (Length: 458)

Name: NF0227_low_4
Description: NF0227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0227_low_4
NF0227_low_4
[»] chr1 (1 HSPs)
chr1 (209-436)||(6299955-6300182)


Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 209 - 436
Target Start/End: Complemental strand, 6300182 - 6299955
Alignment:
209 caggatattttgaaagcaatttcatcgagacaaaagtgggatttaaacgatgttcgagttttcaacttcgatgttgctaaaatcagattcggaacttctc 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6300182 caggatattttgaaagcaatttcatcgagacaaaagtgggatttaaacgatgttcgagttttcaacttcgatgttgctaaaatcagattcggaacttctc 6300083  T
309 aaaactaccaatttcgaatcggctcgagtaagaacaatttcaccgtcaaattttcagatgaaatttcatcttggaatcacaacaagttcacaacaacacc 408  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6300082 aaaactacctatttcgaatcggctcgagtaagaacaatttcaccgtcaaattttcagatgaaatttcatcttggaatcacaacaagttcacaacaacacc 6299983  T
409 aaaaccagatttagcttctcttgatgat 436  Q
    ||||||||||||||||||||||| ||||    
6299982 aaaaccagatttagcttctcttgttgat 6299955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University