View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0227_low_6 (Length: 399)
Name: NF0227_low_6
Description: NF0227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0227_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 81 - 303
Target Start/End: Original strand, 49778336 - 49778558
Alignment:
Q |
81 |
acagacccagttaccaaaattcgaaaatgggtttaacccagattgtaaaaaggaattgggttatcagaaaaagtgtaaaaattaggtcttttttatatgt |
180 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49778336 |
acagacccagtaaccaaaattcgaaaatgggtttaacccagattgtaaaaaggaattgggttatcagaaaaagtgtaaaaattaggtcttttttatatgt |
49778435 |
T |
 |
Q |
181 |
cggcgattcaaagggtggtttgacgaatgtggaaatttgtttgaaagggttcgaaagaaaggagtgtgttgggaaagaggaagaatgaccgtcgtaattg |
280 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49778436 |
cggcgattcaaagggtggtttgacgaatgtggagatttgtttgaaagggttcgaaagaaaggagtgtgttgggaaagaggaagaatgaccgtcgtaattg |
49778535 |
T |
 |
Q |
281 |
aaggcggtggtcggtggtcggtg |
303 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
49778536 |
aaggcggtggtcggtggtcggtg |
49778558 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University