View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0230_high_4 (Length: 201)

Name: NF0230_high_4
Description: NF0230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0230_high_4
NF0230_high_4
[»] chr2 (1 HSPs)
chr2 (1-147)||(19587684-19587830)
[»] chr3 (2 HSPs)
chr3 (4-61)||(12895243-12895300)
chr3 (82-120)||(12895169-12895207)


Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 19587830 - 19587684
Alignment:
1 gattgcagtttttgattggcatagaatagatagctctattgctttgttgaaaattccgagtctgcgttctttttcatctaatttcttgatttcatgcatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19587830 gattgcagtttttgattggcatagaatagatagctctattgctttgttgaaaattccgagtctgcgttctttttcatctaatttcttgatttcatgcatc 19587731  T
101 tttctcttccgtgtgttgttgagttttgttccagcattctttctctc 147  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
19587730 tttctcttccgtgtgttgttgagttttgttccagcattctttctctc 19587684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 4 - 61
Target Start/End: Complemental strand, 12895300 - 12895243
Alignment:
4 tgcagtttttgattggcatagaatagatagctctattgctttgttgaaaattccgagt 61  Q
    |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||    
12895300 tgcagtttctgattcgcatagaatagatagctctattgctttgttgaaaattccgagt 12895243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 82 - 120
Target Start/End: Complemental strand, 12895207 - 12895169
Alignment:
82 tttcttgatttcatgcatctttctcttccgtgtgttgtt 120  Q
    |||||||||||||| | ||||||||||||||||||||||    
12895207 tttcttgatttcatccttctttctcttccgtgtgttgtt 12895169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1449 times since January 2019
Visitors: 2391