View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0230_low_12 (Length: 201)
Name: NF0230_low_12
Description: NF0230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0230_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 19587830 - 19587684
Alignment:
Q |
1 |
gattgcagtttttgattggcatagaatagatagctctattgctttgttgaaaattccgagtctgcgttctttttcatctaatttcttgatttcatgcatc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19587830 |
gattgcagtttttgattggcatagaatagatagctctattgctttgttgaaaattccgagtctgcgttctttttcatctaatttcttgatttcatgcatc |
19587731 |
T |
 |
Q |
101 |
tttctcttccgtgtgttgttgagttttgttccagcattctttctctc |
147 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19587730 |
tttctcttccgtgtgttgttgagttttgttccagcattctttctctc |
19587684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 4 - 61
Target Start/End: Complemental strand, 12895300 - 12895243
Alignment:
Q |
4 |
tgcagtttttgattggcatagaatagatagctctattgctttgttgaaaattccgagt |
61 |
Q |
|
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12895300 |
tgcagtttctgattcgcatagaatagatagctctattgctttgttgaaaattccgagt |
12895243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 82 - 120
Target Start/End: Complemental strand, 12895207 - 12895169
Alignment:
Q |
82 |
tttcttgatttcatgcatctttctcttccgtgtgttgtt |
120 |
Q |
|
|
|||||||||||||| | |||||||||||||||||||||| |
|
|
T |
12895207 |
tttcttgatttcatccttctttctcttccgtgtgttgtt |
12895169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University