View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0230_low_3 (Length: 314)
Name: NF0230_low_3
Description: NF0230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0230_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 105 - 286
Target Start/End: Original strand, 9973651 - 9973832
Alignment:
| Q |
105 |
actgagatacagaaagaacaaaaatataaaagatttattagcaatgcttgtgctggcaagttaccatttttggttttggccatacttcttggtgtgcact |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
9973651 |
actgagatacagaaagaacaaaaatataaaagatttattagcaatgcttgtgctggcaagttaccatttttggttttggccatacttcttggtgtgctct |
9973750 |
T |
|
| Q |
205 |
actcaattatcttatcttgaattcttataatgctcattaacattatcttggtcgttttcactctttccacaatgttgatatt |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9973751 |
actcaattatcttatcttgaattcttataatactcattaacattatcttggtcgttttcactctttccacaatgttgatatt |
9973832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1386 times since January 2019
Visitors: 2391