View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0230_low_8 (Length: 220)

Name: NF0230_low_8
Description: NF0230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0230_low_8
NF0230_low_8
[»] chr2 (2 HSPs)
chr2 (1-72)||(45113224-45113295)
chr2 (1-72)||(45124507-45124575)


Alignment Details
Target: chr2 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 45113224 - 45113295
Alignment:
1 atgaatcttgacaattatcttagaccaataaatgattttcttcctgatgtcaaagtgaaagtgttggagaat 72  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
45113224 atgaatcttgacaattatcttagaccaataaataattttcttcctgatgtcaaagtgaaagtgttggagaat 45113295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 45124507 - 45124575
Alignment:
1 atgaatcttgacaattatcttagaccaataaatgattttcttcctgatgtcaaagtgaaagtgttggagaat 72  Q
    |||||||||||||||| | |||||||||   |||| || ||||| ||||||||||||||||||| |||||||    
45124507 atgaatcttgacaattgttttagaccaa---atgaattgcttccagatgtcaaagtgaaagtgtcggagaat 45124575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1066 times since January 2019
Visitors: 2388