View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0230_low_8 (Length: 220)
Name: NF0230_low_8
Description: NF0230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0230_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 45113224 - 45113295
Alignment:
| Q |
1 |
atgaatcttgacaattatcttagaccaataaatgattttcttcctgatgtcaaagtgaaagtgttggagaat |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45113224 |
atgaatcttgacaattatcttagaccaataaataattttcttcctgatgtcaaagtgaaagtgttggagaat |
45113295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 45124507 - 45124575
Alignment:
| Q |
1 |
atgaatcttgacaattatcttagaccaataaatgattttcttcctgatgtcaaagtgaaagtgttggagaat |
72 |
Q |
| |
|
|||||||||||||||| | ||||||||| |||| || ||||| ||||||||||||||||||| ||||||| |
|
|
| T |
45124507 |
atgaatcttgacaattgttttagaccaa---atgaattgcttccagatgtcaaagtgaaagtgtcggagaat |
45124575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1066 times since January 2019
Visitors: 2388