View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0231-INSERTION-2 (Length: 189)
Name: NF0231-INSERTION-2
Description: NF0231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0231-INSERTION-2 |
 |  |
|
[»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 2e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 27 - 189
Target Start/End: Original strand, 38231364 - 38231526
Alignment:
Q |
27 |
tttttcatgtaaaagaaaaaagatcaaacttgcttcagccttgcaagtggtatttctacacatgaagaaacaatggaaatgattgggagctttgatttga |
126 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
38231364 |
ttttttatgtaaaagaaaaaagatcaaacttgcttcagccttgcaagtggtatttctacacatgaagaaacaatggaaacatttgggagctttgatttga |
38231463 |
T |
 |
Q |
127 |
agccgagccaattacaacagaatattagaattatgttatgaatttggttttggtttctttgga |
189 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38231464 |
agccgagccaattacaacagaaaattagaattatgttatgaatttggttttggtttctttgga |
38231526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 42 - 182
Target Start/End: Complemental strand, 19831151 - 19831011
Alignment:
Q |
42 |
aaaaaagatcaaacttgcttcagccttgcaagtggtatttctaca-catgaagaaacaatggaaatgattgggagctttgatttgaagccgagccaatta |
140 |
Q |
|
|
||||||||| ||||||||||| | |||||||||||||||||| | || | ||||||| ||| |||||| ||||| ||||||||| |||||||||| |
|
|
T |
19831151 |
aaaaaagattgaacttgcttcaacgttgcaagtggtatttctatggcttggaaaaacaatagaagggattggaagcttggatttgaagtagagccaatta |
19831052 |
T |
 |
Q |
141 |
caacagaatattagaattatgttatgaatttggttttggttt |
182 |
Q |
|
|
|| ||||| ||||||| ||| |||||||||||||||||||| |
|
|
T |
19831051 |
cagcagaaaattagaa-tatcatatgaatttggttttggttt |
19831011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 42 - 156
Target Start/End: Original strand, 55862915 - 55863030
Alignment:
Q |
42 |
aaaaaagatcaaacttgcttcagccttgcaagtggtatttctac-acatgaagaaacaatggaaatgattgggagctttgatttgaagccgagccaatta |
140 |
Q |
|
|
|||| ||| |||||||||||||||||||| | ||| ||||||| |||||| |||| ||| ||| |||| || ||||| |||||||||| ||||||||| |
|
|
T |
55862915 |
aaaatagaccaaacttgcttcagccttgccaatggcatttctatgacatgatgaaataatagaagtgataggtagcttggatttgaagcatagccaatta |
55863014 |
T |
 |
Q |
141 |
caacagaatattagaa |
156 |
Q |
|
|
|||||||| ||||||| |
|
|
T |
55863015 |
caacagaaaattagaa |
55863030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 188
Target Start/End: Complemental strand, 30152154 - 30152121
Alignment:
Q |
155 |
aattatgttatgaatttggttttggtttctttgg |
188 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
30152154 |
aattatgttatgaatttggttttggtttctttgg |
30152121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 188
Target Start/End: Complemental strand, 7694936 - 7694903
Alignment:
Q |
155 |
aattatgttatgaatttggttttggtttctttgg |
188 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
7694936 |
aattatgttatgaatttggttttggtttctttgg |
7694903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University